Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig95
Contig Information
Length 876 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12d04    rwhgc12d04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit uroporphyrinogen III synthase [Hordeum vulgare]
Score 923
Evalue 1.08545e-97
Total Hit Count 116
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig95
CTGTCTTGCGGGATGAAAAGTTTGACTGGATTACTGTAACATCTCCTGAGGCAGCTGCAGTGTTCCTTGAGGGATGGAAGGCTGCTGGAAGTCCTAAGGT
CCGAATAGCAGTTGTTGGAGCAGGTACTGCAAGAACTTTTGATGAAGTATTGCAATCCAGTGATGGATCCCTTGAGGTTGCATTTTCTCCTTCCAAAGCT
TTGGGCAAAGTTTTGGCCTCAGAGCTTCCAAGGACTAGTGAGACTGCCTCTAAAGTGTTGTATCCTGCATCCGCAAAGGCTGGCCATGAAATTCAGAATG
GGCTGTCAGCTCGAGGATTTGAGGTGACAAGACTGAACACATATTCAACCGTACCTGTACAAGATGTAGACCCACAGATTTTAAAGCTTGCTCTTTCAGC
ACCAGTTGTTGCAGTAGCTTCTCCATCTGCACTCCGAGCTTGGCTAAACCTCATGTCACGGGTCGACAACTGGAGCAACTCGGTCGCCTGCATAGGCGAG
ACGACGGCTTCAGCGGCCAAGAAACTCGGCCTGGAGAGCGTATACTATCCTGCAACCCCTGGACTCGAAGGGTGGGTTGAAAGCATCCTGGAAGCGCTCA
GAGCCCATAAGCAATCGTCCAAGTGAGGCGTCGGCAGCTCTCTTGAGTTTTCTTTCGCGGTTCCTGTCGTAACCTTCTCTGTTTCTCACTAGGCCCCAAA
GTGTCGGAGACGAGCACGGTTGATTGACCGGCCGCTGTAGCCTGTACTACTGTAGTAGGTGCATTTTTTGAAGGAACATGTGTTTTGTACTTCTGTTTCC
TGCTAATCACACACACGCTATGCGTGCTTTTGCACCGTGCGTGAAGGGAGCCGGGGCATCATCGGCATGTAAATCT
page-top