Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig93
Contig Information
Length 537 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc13f07    rwhgc13f07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit P-type ATPase [Hordeum vulgare]
Score 429
Evalue 7.1533e-41
Total Hit Count 449
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig93
ATTCAACGAAGTGAACAGCAGGGAAATGGAGAAGATCAACATTTTCCGCGGTCTCATCGGCAATTGGGTCTTCCTCGGGGTAATAAGCGCGACAGTGGTA
TTCCAAGTGGTGATCATCGAGTTTCTCGGCACTTTTGCAAGTACTGTTCCACTCAGCTGGCAATTCTGGTTGGTGAGCGTGGGTCTTGGATCCATCAGCT
TGATTATTGGAGCTATCTTGAAGTGCATTCCAGTTAAATCAGGTGAAATCTCTGGAAGTCCAAATGGTTACAAGCCGCTCGCCAACGGCCCTGATGACAT
ATAGCTGGAGAAGGGTGATTTCAGGATGGATCCAGGCTGCATTTGCTATTTTGGCTCTGTTGCATCGCCAGCCGCTAATTTTCTTGAATTCATTTGTAGT
GCGAGTGTGCGCTGCAGGATTGCTTTTTGGTGCTGCATTTGTTTGGGAAGTCAACTCCGGCTTGAGAATCCTATTGCTGGATTTGGATTTATTTGCATTT
GAATGCAGTGTAAGACTTTTTTTTGTCAAAAAAAAAA
page-top