Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig92
Contig Information
Length 604 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12h03    rwhgc12h03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Ras and Rab interactor 3 [Rattus norvegicus] >gi|149025376|gb|EDL81743.1| Ras and Rab interactor 3 (predicted) [Rattus norvegicus]
Score 74
Evalue 0.0652595
Total Hit Count 121
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig92
CCGTACCTGGATGCCGCTCGACGGCGACGAAGATACGCGGGTGTTGCCAAGCGTGCTTCGGTGCTCCGCGACCGCGATGGCCGTGGACAGTACCGCTAAT
TGCAGCCACTAGATCCAGGAAGGAGGCGGTGACCACGACTTGCGCGGCAACCAGGCGCCCAGGCCAGTCTCCTCGCCGGAGAAGAGGAGGAGTGGTCGGC
ACGCTGAACGCCGTGTCCTAATGGATCTCGCCCGACGATCCTTGGCGGCACCGGCGGCCACACGCGAGAACCATCACGGCAGGGCGGCACCGTCACCGGA
TAGCGTGGACCACACGACCGTCAAGCCACTTGCAGCTCCGCCGACCCGACACACGCGCAGGCGGTGGACGGGAAGGTTGGTTCCCGGCGTTAATTGGCGG
CGGAGCGGCCAAATTTCGGCGGTCGGAGGCGGCGATTTTGGAGGCTGTACCGGAGGGAAAAGGGGGATGGGAACGCGTTGAGAATTGAGATAGACGTGCT
CGCGCGAGTGATTTGTGGACTTTTTGGTATGCTGCTCCGCGTTGGTTTGTTTGTANAGACATGTGTTTTTGTANGGTCCANCGATTCTTTTTCCAAAAAA
AAAA
page-top