Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig91
Contig Information
Length 1093 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12d10    whgc17a15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 1,4-beta-D-mannan endohydrolase precursor [Hordeum vulgare subsp. vulgare]
Score 1672
Evalue 0
Total Hit Count 332
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig91
GCGCGGTTCCGGTGGGCGGCCGGCCGTTCTACCCGAACGGCTTCAACGCGTACTGGCTCATGTACATGGCGTCCAACCCCGGCGACCGGAGCAAGGTGCT
CGCCACGCTGGACCAGGCGTCCCGCATCGGCGCGACGGTCATCAGGACCTGGGCCTTCAACGACGCGGGCAGCAACCGGCCGCTGCAGATTACCCCCGGC
GTCTACAGCGAGGACGTGTTCCTGGGACTAGACTTCGTGATCGCCGAAGCGAAGAAGCGAGGTCTCTACTTGATCCTGAGCCTGGCGAACAACTGGGGTG
ACTTTGGCGGGAGGAGACAGTACGTGCAGTGGGCTAAGGACCAGGGCCACAACTTGGGCTCCGACGACGACTTCTTCACGGACCGCCACACCCAGCGCTT
CTACATGAACCACATCAAGAGGGTCCTCACGAGAGTCAACAACTTCACGGGTGTGGCGTACAAGGACGAGCCCAGCATCTTTGCATGGGAGCTGATGAAC
GAGCCCCGCGTCCCCAGCGACCTCTCCGGGAAGACCATGCAGGCCTGGGTGGCGCTCATGTCCTCCTACGTCAAGTCCGTCGACGGTAAGCACATGGTGG
AGATCGGCCTCGAGGGCTTCTACGGGGACTCCGCGCCGCAGCGCAAGCGGTTCAACCCCGGTGGGAATTACAGCGCGGGCACCGACTTCATCGGAAACAA
CCGCATCTCCACCGTCGACTTCGCCACCATCCACTCCTACCCCGACCAGTGGGTGCCGGGGTCGACAAGCGAGCAGCAGGTGGAGTTCATGAAGAAATGG
ATGGCGTCGCATACCGAGGACGCGGCGTCGGCGCTGCGGAAGCCGCTGCTCGTGGCGGAGTTCGGATGGAAGTCCAGCGGCAACGCGGTGGCGCANCGCG
ACGACTACTTCCGCATGGTGTACGACGCCNTCTACNCGTCNGTGAAGGGGGGCGGGCCGTGCGCCGGGGGCCTCTTCTGGCANGTCATGGCNCCCGGNAT
GGANANCTGGGCCNACNGCTACNANGTCNTGCTTNANCNTANCCCCTCCNNNANCNNCNTNNTNTNCNNNNANTNNNCTNNNATNNNNNNAAT
page-top