Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig90
Contig Information
Length 820 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc13e24    rwhgc13e24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_015045 [Oryza sativa (japonica cultivar-group)]
Score 839
Evalue 5.31059e-88
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig90
CATTCCTTGGACATGCTGACGAGGTCGTTGAGGAAAGAATTTCTGATGATGAAATAATTCTGGTGAAAGGCACAAAGAACACAAGTGCGGTTTCCATTAT
ACTCAGAGGAGCAAATGACTTCATGCTAGACGAGATTGAACGGTCTTTGCACGATGCACTGTGCATTGTGAAGAGAACTTTGGAATCCAATACGGTAGTT
GCTGGTGGTGGTGCTGTAGAAGCTGCATTATCTGTGTACCTGGAGAATCTTGCTACAACTCTTGGATCCAGGGAACAACTGGCGATTGCTGAATTTGCAG
AATCTTTGTTGATCATACCAAAGGTCCTCGCTGTTAATGCCGCAAAAGATGCAACTGACCTTGTTGCAAAGCTTAGGTCATATCATCATAAAGCTCAAAC
AAATGCTGATAAGCAGCACTTGTCAAGCATGGGTCTTGATCTGACAAAAGGTGTAATCCGCAACAACCTTGAACATGGCGTGATTGAGCCAGCAATGAGC
AAAGTGAAGATCATTCAGTTTGCAACAGAAGCAGCCATTACCATTGTGAGGATTGACGACATGATCAAGCTTGACAAGGAAGAGTCTGGCCAAGAAGAGT
AGCCACTTGCCATTTTACGACCCCTGGTTGCTGTTTGTTATGCCATGGCTGGTTGCTTATAGACTCTTAGATGCTGCTTGTGATTTTCCTTTTCTTCCTC
TTTGTATTGGCGGACGTTCTCGTAGAATGTTGTACGGAAGATGGATGTATGGGTGATTGAGTGTATCATTATGTGTGGGTAGTAGGACTCGTGAATGGAA
GCAAATTTTGCCTGCCTGCA
page-top