Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig84
Contig Information
Length 810 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc13e07    rwhgc13e07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0716500 [Oryza sativa (japonica cultivar-group)] >gi|42408040|dbj|BAD09176.1| putative delta-12 oleate desaturase [Oryza sativa Japonica Group] >gi|45735853|dbj|BAD12887.1| putative delta-12 oleate desaturase [Oryza sativa Japonica Group] >gi|113537458|dbj|BAF09841.1| Os02g0716500 [Oryza sativa (japonica cultivar-group)] >gi|125540897|gb|EAY87292.1| hypothetical protein OsI_08694 [Oryza sativa Indica Group] >gi|125583461|gb|EAZ24392.1| hypothetical protein OsJ_007875 [Oryza sativa (japonica cultivar-group)]
Score 761
Evalue 5.75816e-79
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig84
TCGCCTTGTTGAAGCTCGTGTCGTCGTTCGGGTTCTGGTGGGTGGTGCGGGTCTACGGCGTGCCGCTGCTGATCGTGAACGCGTGGCTGGTCCTGATCAC
CTACCTGCAGCACACCCACCCGGCGCTGCCGCACTACGACTCGACGGAGTGGGACTGGCTGCGCGGGGCGCTCGCCACCATGGACCGCGACTACGGCATC
CTCAACCGCGTGTTCCACAACATCACAGACACGCACGTGGCGCACCACCTCTTCTCCACCATGCCGCACTACCACGCCATGGAGGCCACCAAGGCGATCA
AGCCCATCCTCGGCGAGTACTACCAATTCGACCCCACCCCCGTCGCCAAGGCCACATGGCGCGAGGCCAAGGAGTGCATCTATGTCGAGCCCGAGGACCG
CAAGGGGGTCTTCTGGTACAGCAACAAGTTCTAGCCGCCAAGATCCATCAACTGTGCTCGAGAAAGAACTCAGAGAAGAGATCCTCCCAAGTAATTCCAT
CCATCTACCTACAGTCCATATGGTTAGTCTTTAGATAGCAGAGGGCATTTGGGCACAAAAGAAGACTACTATTACCGTGCCAATGCTAGAAGAGTTGAGT
GGTGCAAGGAAGAGTAGCGTGTCCGTGACTTTGGTCAGTTCCGTCTTTACTTTTTCTCTGCGTTCTAGTCGTCGGCTTAGGTTTGGCCGGCGGTCGTCGT
TGGTGTCCGTGGCCGTGGACATGGCCGCGTGTGTTGTGTGTGCGTCTGTCATTGCATTGGCGTCATCTTCCCCCGTCCGTGTCATGTTGTTGTAGACCAT
TTGGTGTTTA
page-top