Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig82
Contig Information
Length 651 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc13a16    rwhgc13a16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0403500 [Oryza sativa (japonica cultivar-group)] >gi|38346147|emb|CAD40678.2| OSJNBb0118P14.7 [Oryza sativa (japonica cultivar-group)] >gi|113564270|dbj|BAF14613.1| Os04g0403500 [Oryza sativa (japonica cultivar-group)] >gi|215704500|dbj|BAG93934.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215736991|dbj|BAG95920.1| unnamed protein product [Oryza sativa Japonica Group]
Score 567
Evalue 1.16943e-56
Total Hit Count 71
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig82
CCTCGTGCCGATTACAACCTTCCATCCTTTCTCCTTACCCCGGGCTATTTCACTGGTAAGAGAAAGGCTGAATCTGAAGTCCTCTCCAAATACCCATCCT
CAGGTGTTGTATTGAGGCCTGGGTTTATTTACGGTAAAAGGAAAGTCGATGGCTACGAGATACCACTCGACATAGTAGGACAACCACTAGAGAAGCTACT
TTCCTCTGTCGAAAATTTCACCAAACCATTGAGTGCATTGCCTGGTTCGGACCTGGTCCTTGCATCCCCTGTGAACGTGGACGATGTCGCCTACGCCGTG
ATCAACGCCGTCATAGACGACAGCTTCTTTGGCGTATTCACAATCGAACAAATCAAGGAAGCGGCAGCCAGTGCCAGAGTGTAGAGATCTCCATATCTGG
AAGTACCTTACGAGGGATGCTCGTGTTGTTGCAAATCTTCCATAATAGGGGATAGCTCAAGGCCAAACTCAGTACTGCAATGCTGTGCTTAGAGAGTTTA
AATGCACTAACACAATCCATTCCAAAAGCTGTAGTTGTTCATAGCAGGCAACACTCTTCACAAGGGTTCATCTTGTAAGCGGCCCATGCATACATAGCTG
AAATACGAGCACAAAAATGGGTTGCAACAAGCTTCACCATCAAAAAAAAAA
page-top