Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig81
Contig Information
Length 658 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc13e03    rwhgc13e03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit metal-dependent phosphohydrolase, HD subdomain [Zea mays]
Score 584
Evalue 1.26379e-58
Total Hit Count 356
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig81
TGGGATTCAAAAACGAGGTTTCAAATAAGCTTAATGCGGAGCCCACTCTTGAGTTTGCAATCGTGCAAGATGCAGATCGTCTGGATGCAATTGGTGCGAT
TGGTGTTGCAAGATGTTTTACATATGGAGGGAGCAAGAACAGTGCATTGCATGATCCTAACGTACTTCCACGGGATAATTTGTCAAAGGAGAAGTATATG
TCCAAGGAGGAGAAGCAAACATCAATTAATCATTTCCATGAGAAACTTTTTAAGTTGAAGGACATGATGAAGACCGAGGCTGGGAAAAAGAGAGCAGAGA
AAAGGCACAAGTTCATGGAGAATTTTGTGGCTGAATTCTATGAAGAGTGGAGTGGCAGGGCTTGAAGTTGACCAACCAGACCGTGGGCTGGGAGGGCAAG
GCTTGAAGTTGGCCAACCAACTTTCACCAACTCACATCGATAAAAATCCATGGATTACCATCTGGTTTTACATCACTGTTTAGGTTCCCATGAAACTTTC
CCCAAAACGCTAGAGCTCTGAATATAATGAATAAATGACAAGACTATTTACCAGATATTTCACAGAGTCCCTGGATGTTGCCTATGTTTTTCTTTTTCTG
ATTAAAACTCTGAAAGATTGCTCTTTGGTAATATAAGCAGTTCTATCTNAAAAAAAAA
page-top