Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig80
Contig Information
Length 726 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc13e02    rwhgc13e02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0565000 [Oryza sativa (japonica cultivar-group)] >gi|33146750|dbj|BAC79661.1| putative 40S ribosomal protein S11 [Oryza sativa Japonica Group] >gi|50508298|dbj|BAD30107.1| putative 40S ribosomal protein S11 [Oryza sativa Japonica Group] >gi|113611543|dbj|BAF21921.1| Os07g0565000 [Oryza sativa (japonica cultivar-group)] >gi|215768067|dbj|BAH00296.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218195559|gb|EEC77986.1| hypothetical protein OsI_17372 [Oryza sativa Indica Group]
Score 731
Evalue 1.41556e-75
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig80
TCAGAGCCTTGCTCCCGCATCCCCGCGCCGCGCCGCCGCCGCCGCCTCCGAGCCCCTCGAAGCCCACCTCGCAGCCATGGCGGAGCAGACCGAGAAGTCT
TTCCTCAAGCAGCCAAAGGTTTTCCTCAGCACGAAGAAGGCTGACAAGGCAAAGAGGCCTGGCAAGGCTGGCAACCGCTTCTGGAAGAGTGTTGGCCTTG
GTTTCAAGACCCCAAGGGAAGCGATCGATGGTACCTACATTGACAAGAAGTGCCCATTCACTGGAACTGTTGCCATCAGGGGCAGAATCATAGCTGGAAC
CTGCCACAGTGCCAAGATGAACCGGACCATCATTGTTCGCAGGAACTACCTTCATTTTGTGAAGAAGTATCAGAGGTATGAGAAGAGGCACTCCAACATC
CCAGCTCACATCTCCCCCTGCTTCCGTGTCAAGGAAGGCGACCATGTCATCATTGGCCAGTGCAGGCCCCTGTCGAAAACCGTGAGATTCAATGTCCTGA
AGGTCGTTCCAGCTGGAACCACCGGAGGCGGGAAGAAGGCTTTCATCGCTGCCTAAGCCCAGACTCTGATTTATGAGTAGTTCATAGTCAGAACTTTTTC
GCACTTGAAATCTACCAGGCTGCTGTTTCGAGATTTGATTCCGTGTTATCTGTCAAACCGAATGTCCTGATCTGAACATGTTTTGTGGAATCTATCTATC
ATTAATAGTTTCGCTTAAAAAAAAAA
page-top