Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig78
Contig Information
Length 757 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc13d23    rwhgc13d23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_25404 [Oryza sativa Indica Group]
Score 679
Evalue 1.63225e-69
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig78
AGAGCGGCAGCTCGCGCGCGCGCGCCCCCATTGCCGCCGCAGCAGGAGCCCGCCGATTCCAATCCAAGGAGGAGCTTTGAAGGTTTGTCAGGGCGGAGAA
GATGGTTCTCAAGACAGAGCTCTGCCGTTTCAGCGGTGCCAAGATATACCCAGGGAAGGGTATCAGATTCATCCGCTCAGACTCTCAAGTCTTCCTTTTC
TCCAACTCAAAGTGCAAGAGCTACTTCCACAACCGTCTCAAGCCAGCTAAACTCGCATGGACGGCCATGTACAGGAAGCAGCACAAGAAGGATATTCATG
CTGAGGCTTCAAAGAAGAGGCGCCGCACCACCAAGAGGCCGTATTCCAGGTCAATTGTAGGTGCTTCCCTTGAAGTTATCCAGAAGAAGAGAGCTGAGAA
GCCGGAGGTCCGTGATGCAGCCAGGGAAGCAGCTCTGCGTGAGATCAAGGAGCGGATTAAGAAGACCAAGGATGAGAAGCGAGCAAAGAAGGTGGAGGTG
ACAAAATCCCAGAAGACCACCGGCAGAGGCAACGCCCCCAAACCTGGAAAGGCCCCCAAGCTTGGCGGTGGTGGCGGGAAGCGCTAGATGGAGTCCCTTA
CGATCAATGTGAAATTTTGAACCAGTTGCATGATGTCTTACCCCGTATCTTTTAGGAAGTTTTTTGCTCAAACCAGCTGTTGCTGTCGGTATGCAGCATC
TGGGTGCACAAACCAGTGGTGGATCAGTGTGAAAGATTGTTTTATGTTCTCATCAAT
page-top