Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig77
Contig Information
Length 568 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12e17    rwhgc12e17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100191957 [Zea mays] >gi|194690274|gb|ACF79221.1| unknown [Zea mays]
Score 117
Evalue 0.000128046
Total Hit Count 15
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig77
ATGCCGATACCTTCACCCCCAGTGCCTCATTTTCGACATTCCATTCCTCCACGGAAGAAACGAAGTGGCACAACAACCAAGTCTCCTCCAATTGCTCCAT
CTCCGTATTCTCTCCTCCATTCCTGAAGTGATGGTCAGATTGCTTCCAATGTATCTGCTCCATTGTTCACAAATCTATCCTGAATATGAGGTCGATGTGG
TTGCAATTTTGCTGCTTGGAACTTCCTGAACTGGGAAGATGCTGCAAAGGCGGGTTCTGTGTATGGTGAATTCCGGACCATCTGAGGCGGATATAACTGT
AGATATAGGTCTATATTATGCTAATTTACAGGGCTTTATGTTGCCTTACGCCTTTACCAAATTGTAAGGTCTCACCGAAGGGTTGGGGACTTGTGGTAGA
GAAGAATGTGTACTCTTAAGGTCTCGCCGAAGGGCTGGGGGCTTATGGTAGAGAAGAATGTACTCATGCTCTTACCTGTGACATATTCAGCATACTACAA
CGCTCATCTTTGATGTGGCATTTCATGCCGTGGGCCTTTTCGTGCTGAGTGGTAATTTAAAAAAAAAA
page-top