Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig72
Contig Information
Length 889 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc13d05    rwhgc13d05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit MCB2 protein [Hordeum vulgare subsp. vulgare]
Score 958
Evalue 9.78912e-102
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig72
GCAGGGAGAAATTATGCTCTGCGAAGGAGGTGGCGGCAGCAGCAGCGGTAGTGGGCTGAGGCTCTTCGGGGTGCAGGTCCATGTCGCTGCGGGCCGCAGC
ACCGGCCTCGGCGCCTCCATGAGGAAGAGCTACAGCATGGACTGCCTGCAGCTCGCGGTGGCCCCTAGCTCCATCGTCTCGCCTTCGTCGTCGTCTTCCT
CGTCGGTGCTTCTGTCCATCGATGAGGGCTTGGAGAGGGCTTCCAATGGGTACCTGTCTGACGGTCCTCATGGCAGATTAGTCCAGGAGAGGAAGAAAGG
AGTTCCATGGAGCGAAGAGGAGCACCGGCTATTCCTCGTGGGCCTCGAGAAGCTGGGAAAGGGCGACTGGCGAGGTATCTCCCGGAGCTACGTCACGACT
CGAACCCCGACGCAGGTTGCCAGCCACGCGCAGAAGTTCTTCCTGAGGCAGAGCAGCATGGGGAAGAAGAAGCGCCGCTCCAGCCTCTTTGACATGGTAC
CGATCTGCGAGAACGGCATTCGCGTTTCTGAGCCGCTGACCAACAACGGCGAAGGTGCCTCCACCTCTCTGCCGCGGTATAAATCCCCCGACATGTCCAT
TGATCTCAACTCCACGCAGGAGGATGACATGGCGATGGCGGGGGTTCCACTTTTGTCGGAGTCACCGAGGGCGCCATTCCCGGCGGTTCTGATGGAGCAG
CCTCCTCATGGCCACGGGCACGGTCACCACTGCTCCCCGCTGGACCTGGAGCTGGGCATGTCTCTCTCGCCGCCGTCCATCGGAACATGACGTCAACGAC
GTGGCCGGCAGGAGAGGAGACCCAGGACGCTCGACCCAGTTTTTATTTTTTATTCTATCACTTATCAGGCTGTGTCTGCTGCCTAAGCC
page-top