Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig71
Contig Information
Length 807 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12f11    rwhgc12f11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0447700 [Oryza sativa (japonica cultivar-group)] >gi|113564489|dbj|BAF14832.1| Os04g0447700 [Oryza sativa (japonica cultivar-group)] >gi|215766035|dbj|BAG98263.1| unnamed protein product [Oryza sativa Japonica Group]
Score 901
Evalue 3.36013e-95
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig71
AACCTGCAGATGGAGTACGTGGACCTGTACCTGATCCACTGGCCGATAAGCCTGAAGCCCGGGCCGGCGGTTTTCCCGGTGAAGCGGGAGGACGCCGTCC
CGTTCGACTTCGCGGGCGTGTGGCGCGCGATGGAGGAGTGCCACCGCCTCGGGCTCGCCAAGGCCATCGGCGTCAGCAACTTCACCACCAGCCACCTCCA
CAAGCTCCTCGCCGCTGCCACCGTCCCTCCTGCAGTCAACCAGGTGGAGATGAACCCGGTCTGGCAGCAGAGGAAGCTGAGGGAGTACTGCGCCGAGAAG
GGCATCCACGTCGCGGCCTACTCGCCGTTGGGAGGGCAGAACTGGTCCGGCGACGGCAACGCCGTCCTGGACTCCGAGGTGCTCGCGGAGATCGCCAAGG
CTAGAGGAAAGACCGTTGCACAGGTAGCACTGAGGTGGATTTACGAGCAAGGGGCGACCCCGATCGTCAAGAGCTTCAGCAAGGAGAGGCTCAAGGAGAA
CCTCGGGATCTTCGACTGGGGGCTCACCGACGACGACCTGCGCAAGATCGGCCAGATTCCGCAGAAGAAGATCGTCAGAGCTGAAACCGTGCTGTTCTCG
GCGGAGGGCGAGTTCACGTCGGCTGACCTCGCGGAGATGGAAATTGTCGAGGAATAATATAGGCACCGAGAATGCCTTCTTCGCTGTGTGACGTAAACTG
CAGTAGCTTGCATAAAGAGTGGGGATGAATAAAGAAGTGATCCGTGCTGTATCCTGTTATTCCTCTTTTCGGATTCAAGTTGTCAGTGAAGACTGTGATC
ACCGTGC
page-top