Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig68
Contig Information
Length 1223 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12f12    rwhgc12f12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_13437 [Oryza sativa Indica Group]
Score 1193
Evalue 9.04781e-129
Total Hit Count 91
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig68
GCTTGCGCAGCTTTGTGTTTTCATAGAACAGACAACGATTCCTAAAGTTACAGAGGACTTGGCTGATTCTTTCTCTGGAGGGGGAGCACGTAGCTCTGAA
TATGGACCACCTTTTGTACCTGGGGAGATATGTCGTCTATATCGTTCATCTGGGGAGAAATTCTTACAACATTACATAAATATAAAGACTCAGAAGATTT
CCAAACTTCTTAATAAGCGATTTTCGACACCGGTCTGGCTAAAGCACAAGGAACCACGGGAAGTTAACATGTTTGTTGATCTACTTCTCCTAGAGTTCAA
TGGCGTAGTATCTGAAGTCAAGCAGATCTTACCTGGTTTAATCCGGCGGCATCGGCATTCTGATAGCACTGGCAGCACCACTTCCTCTAGAAGCAATCCG
ATGCGAGAAGACATGTTGAACCGATCAAACACAAACCGGAGTAGAAGTCAATTTCTAGAAAATCATCTAGCAAAATTATTCGAACAGAAAATGGAAATAT
TCACCAAACTTGAATACACACAGGAATCTGTAATTTCTACTGTCCTCAAGCTTTGCCTGAAAAGTTTGCAAGAAATTGTCCGGCTTCAGACCTTCAACAG
AAGTGGATTTCAGCAGATTCAGTTGGATATGGAATTTCTGAAGAGCTCCCTCAAGGAGTTTATTGATGATGAAGCAGCCATAAGCTTTTTACTTAAAGAG
GTGAACAATGCTGCACACGAGAGATGTCTTGACCCGATACCTCTTGAGGCCCCAATATTAGATAAACTCATAAATGCAAAACTGGCAAAAATCAAAGAGC
AAAGCGCGAATATGTAGTAGCTACCCACACATTGTATCTCTCAGCAGCATTCAGTTTTACTCCATTTAATACATAGTGTTCAAGCTATGTGCATATAGTT
GTGGGCTTGTGGCATGCCACCATCTGTAATATGTAAATCAGAGGTCAAAACACTCGAACTGAATCGACAATGCCTGAAATGTATACTTCTTGACCTCTCA
GTGTCCCATTCTGCCATTGTATTGTCATGAGTCTTGACTCCAGAGTTGAGGTAAATTGTGAGCAACCTAAGGCCAGAAGGCGGAAGGAGAACTGTGTTAT
GCTATGCATATAATTGAGTGGACATTTAGAAGCTGTTGAATGCAGAAAAAAGATGCAATACTGGGCCGCACCTCATGGAGAAATTATGAGGTACTACAGA
CTGTATCCCATGCCACAATATGT
page-top