Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig67
Contig Information
Length 1078 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12h08    rwhgc12h08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit vesicle-associated membrane protein-associated protein [Triticum aestivum]
Score 1006
Evalue 3.62631e-107
Total Hit Count 458
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig67
GGCACCTTTTTTGCCCGAGACAGTAGGAGGACAAGAGCGAGGGCGACCAATAAATTCCTAATTTTTCCCACTTTTCCACCCCGGGATTCCCCCGCCTCTT
GTTCCAATCGATTGGTGGGCGTCCTCGTTCTTGGCTTCCCGATTGAATCCGTGGAAGCCAAAGATAATTCTATCTCCGCTGCGATTTTTTTGGGTGGTTT
GAGTTCTTGATTTGTTTGCGAGGAAGCCACCATGAGCGCCGGAAGCGCGAGTTTCCTCGAGATCCAGCCCTCGGAGCTGGCATTTCCCTTTGAATTGATG
AAGCAGAGCTCGTGCTCCATGCAACTCGCAAATAAGACCGACCATTATGTAGCATTCAAGGTCAAAACTACCAACCCAAAGCAGTACTGTGTGCGCCCTA
ATATTGGCGTTGTACTTCCTGGGTCGACTTGTGATGTTACAGTTACAATGCAAGCGCAGAGGGAAGCACCTCCTGATCTGCAGTGTAAGGACAAGTTCCT
AGTTCAAAGTGTTGCAGCTGAGAATGGTGCAGCAACTCAAGATATTAGTGCAGCAATGTTCAACAAGGAGCCAGGGAAGGTTGTTGATGAATGCAAGCTG
CGTGTAATTTATGTGCCAACATCTTCACCTAGCCTGTTCTCTGAAGATTCAGAACAAGGGAGTTCTGCTCGTTCATTGGAAAACGGGACTCCTAATTCTA
CATTGCCACAATCTGTATTTAGATCATCTGGTGAAGCATCAAAGGAGAAGTCCTCGGAGGCAACATCCATGATTTCCAAGCTAACTGAGGAGAAAATGTC
TGCTGTTCAGCAAAACCAGAAGTTGAGACAAGAGCTGGATGTCCTACGCAAAGAGAGCAGCAAAAGCAACGGCGGTTTCTCAATCACCTTCTTGATTGTG
GTGGGTATTCTGGGCATCATCGCTGGTTTCATCCTCAAGAAGACATAGGAGAAGAGTAGTCCCCAACAAAGTTACATTCCCAGGAAAGGATGGATACCAA
CAACATCCCTTGTGTTTTTACTCCTAAAAGGAGCGCCTGTTCTATTCTAACTTGTAACCGGCTTAGAAGCTTTGGTTT
page-top