Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig65
Contig Information
Length 727 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12g09    rwhgc12g09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0506200 [Oryza sativa (japonica cultivar-group)] >gi|113532680|dbj|BAF05063.1| Os01g0506200 [Oryza sativa (japonica cultivar-group)]
Score 874
Evalue 3.70793e-92
Total Hit Count 412
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig65
AGATCGCATCGCCGCCCAGGGAAACGATGAGCCGCGAGGCCAGCGGCGCGTCGGTGAGCTCTGCCCCGGTGCCCGAGCCAGAGCGGCAGCAGGGGCAGGG
GAACCAAGGGGAGGAGGCGGGGTGGACGCCGCTGGAGAAGGTGGCGGATAAAGTGGAGGAGCTGTACAGTCTCCGTGACACCTTCTTCCCCCGAGACCCC
TCCGAGAAGTCTGCGTCCCTCCGCGCCTGCGCCGACGCCGCCCTGGGAGTCCTCGATTCCCTGCCTCCCGAGCAAAGAAAATCCCCAGAAGAGCGTGTTA
TTTATGAATTTTTGATGGGGAAAATACTCGATGTCTTCCCAGATTATTGTAAGGAGGCTGAAGAGCATTTATCCAAAGCAGTAAAGCTGAATCCATCTCT
TGTGGATGCATGGCTATGTTTGGGTAACTGCATCTGGAAGAAGGGGAATTTGGCATCAGCAAGGAACTGTTTCTTATTAGCACTAAGTAAGGGCACAGAT
AAGAAAATACTATGTCAACTCTCAATGCTTGAAAGGAGTATGGCTCAATCTAGTGAAGACCAAGCGTTGTTAGTGGAAGAGAGCATTAATCATGCAAAAG
AAGCTGTAATGCTGGACATAAAAGATGGAAATTCCTGGTATAATCTGGGTAATGCATACCTCACAAGCTTCTTTGCGAGCGGAGCCTGGGACAAAGCTAG
GCTTCATCATTCGATCAAAGCATATCA
page-top