Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig63
Contig Information
Length 682 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc13b24    whgc14b24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit GRP-like protein 2 [Gossypium hirsutum]
Score 916
Evalue 1.24138e-101
Total Hit Count 79
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig63
ACACACACGCCTTCCTCCTTCCTCTGCTCGCATCTCGGATCGGGGAGAAGGAGGATCTGAGGCTTTCGGCAGGGCCGGGGACGATGGCGCCGCTGCTCAA
GGACGAGCTGGACATCGTCATCCCGACGATCCGGAACCTGGACTTCCTCGAGATGTGGAGGCCCTTCTTCCAGCCGTACCACCTCATCATCGTGCAGGAC
GGCGACCCCACGAGGACCGTCATGGTGCCCGAGGGCTTCGACTACGAGCTCTACAACCGCAACGACATCAACCGCATCCTCGGCCCCAAGGCCTCCTGCA
TCTCCTTCAAGGACTCCGCCTGCCGCTGCTTCGGCTACATGGTCTCCAAGAAGAAGTACGTCTACACCATCGACGACGACTGCTTCGTGGCCAAGGACCC
GACGGGGAAGGACATTGACGCGCTGGCCAAGCACATCCAGAACCTGCTCTGCCCCTCCACGCCGCTCTTCTTCAACACCCTGTACGACCCCTACCAGGAG
GGCGCCGACTTCGTGCGCGGCTACCCGTTCAGCCTCCGGGAGGGCGTGCCCACCGCCGTGTCGCACGGCCTCTGGCTCAACATCCCCGACTACGACGCCC
CCACGCAGCTGGTCAAGCCGCGGGGAGCGCAACGGCAGGTACGTCGACGCCGTCATGACCATCCCCAAGGGCTCCCTCTTCC
page-top