Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig62
Contig Information
Length 454 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc13b23    rwhgc13b23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_32232 [Oryza sativa Indica Group]
Score 475
Evalue 2.48855e-46
Total Hit Count 44
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig62
GTTCTTCAAGAATCAGGGAAAATTCTCCAACCGCGCGACATCGTCAATATCGAGCACTGCTGTGACCGGCGAGATATCGAAGATGGCGGCCCAGGCGGTG
GGTAATTCAGTCTCCGAGTTCCAGTCGGGTTTCAGCGACATGAGGTCGGACATGGCAGCGAGGGTTTCTTTCAAGTACGGGTGCACGAGAGGGGTGGCTG
GCGCGCCGTTCTTCTTCGTGAACGGCTTCCTCCAGCCCGGAGGCGGGTCGCCCATCGACTTCAGCACGTGGACCAGCATCCTGGAGCCCCTCGTCGCGCA
TCACGGCCAGACCATCGAGATGTTCACTTCGGTGTAATGTAAGCATTGCAATCGCCTTTTATATGTTTGGAACCAAAGGATGGCTATTGTACAGACAGCA
GCCCTGTGTGTGTAAACCGGTCGACAGTAGTATTTTGTTCTTCTAAAAAAAAAA
page-top