Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig59
Contig Information
Length 487 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12o17    rwhgc12o17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_008610 [Oryza sativa (japonica cultivar-group)]
Score 116
Evalue 0.000107132
Total Hit Count 11
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig59
GACGACTTCTCAGAGACGGAAATCTGGGGGCGTATGGAAGTGGGTGGGAGGAAGTGCAGAGGTCTCCGACAATGAATAGTTCATCAAGACAAGTAGCCAC
CCAGCAGCGAAACGGAGGCGAAGCTGCTACAGTTTTGAGACGGCTTGTTTGTCGCAGGCTACCGGGCTCCTCCTCAAGAACTTGCCCGCGACTGATTTTG
CGAAGACATCACTGAGAACAGTCTTTTGGATCTTCTGAAGCGGCGACACCTGGTAGAAATATTCCGGGCCGTTTAGACATTGCACAGCAAAAACATGGTA
GTATCATACATATGACAAGTATACCTAAGATTGTACCGGTCTGGAAATATAATTGGTTGGGGATGTTAGCTCTTGTTTTTTTGTTTACCTTTACTGGAGT
TGGTACACAAATATATCTTCATTGGTTCAGGTGACTGGGTGGAAAATACATTGTTTATAGCGTAAATTTACCGACTTAAAAAAAAAA
page-top