Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig57
Contig Information
Length 518 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12k09    rwhgc12k09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_14085 [Oryza sativa Indica Group]
Score 330
Evalue 1.96016e-29
Total Hit Count 108
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig57
CCTCGTGCCGAGCGATCCTCACAGGCTGCAGGTGTTACTTCAACGAGGTGGAGAAATGCTTGAAGCAGGTGGGAAGGATGAAGTACCTACGCCCGCTCTA
CAGCTCGCTTGCACGGTGCTCCGGGGAGGAGGAGAAGATGCTGGCCAAGAGGATCTTCTCGGAGGCCCAAGAGTTTTACCACCCGATAGCCCGCGGCGTC
GCGGAGAGCATCCTCTTGAAGCATGGCTAGTTGAGTTGAAGCCACATTTTACCAAGCCTGAAGTAGAGAGAACATCTTTGATGCCTATTGACTGTTTGCT
CGCTCATTTCTTCCGCATAAAATTTATCTCTCTCCTGGAGCTGACCTTGGGTGAAATTCTGAACTTCCTTCCGTGATGTGTTATGTGAGACTGCGTGTGC
GTAATTTATTCTGACCCTGTAAGGAACTTGAAAACTGTGCCTCCCTGATAACCAATATCCCTGTGGTGATACTGCCATTGTCTCTTAACGGTCATCGTCT
TTTAACTCAAAAAAAAAA
page-top