Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig56
Contig Information
Length 1193 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12h02    rwhgc12h02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0566900 [Oryza sativa (japonica cultivar-group)] >gi|113532896|dbj|BAF05279.1| Os01g0566900 [Oryza sativa (japonica cultivar-group)]
Score 1499
Evalue 2.86698e-164
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig56
GTCCGCGTCCTGTCTCTCCCGGTCAGCGATCGGGAGGGGCGAGGGATGGCCTCCCATCCCCCCAACTCCGCCGACGGCGAGGACCCCGCAGGGAATAACG
CGGAATTGCCATCCCTGCCCTTTCATGTTGTCACTAAACCTAGTCAACTCCCAGTCGAGTTTCTTGAGCCCTCTGCTGCCAAGAAATTGGTGATTGGATT
TGACTGTGAAGGTGTTGACCTTTGCCGCCATGGTGCTCTCTGTATCATGCAGATTGCATTTCCTGATGCTGTTTACTTGGTCGATGCTATTGAGGGTGGA
AAAGAACTAGTTGAAGCTTGCAAACCAGCACTTGAGTCCAATCATGTCACCAAAGTTATCCATGACTGTAAAAGGGACAGTGAGGCATTGTATTTCCAGT
TTGGCATTAAATTACATAATGTGATGGATACACAGATAGCCTATTCCCTGATTGAAGAGCAGGAAGGTAAAAAGAGAGCATATGATGTTTACATATCCTT
CGTGAGCCTTCTTGCCGATCCTCGTTATTGTGGAATGCCATATCCTGAAAAGGAAGAAGTCCGCACCCTTCTAAGGCAGGACCCAAATTTCTGGAAAAAT
AGGCCCTTGTCTGAAATGATGATTCGAGCAGCGACAGATGATGTGCGCTTCCTTCTCAATATACATGAGAAAATGATGGAGAAGTTAAGCAAAGTATCTT
CATGGCGTCTGGCAGTACGAAGTGAGCTATACTGTAGGTGCTTTTGCATAAATGACAACCAGCAGGCAGATTGGCCGCCTCTTCCAACTGTCCCTGATGA
CATTGAAGCTGAAGCTTGTGTTCCTGAAGTGGATATCCTTTCGCTCTTAGATGTGCCTCCTGGAAAAATGGGTCGTGTTATTGGCAGAAAAGGATCATCA
ATAATGGCTGTGAAAGAATCTTGCAATGTTGAAATCCATATCGGTGGTGCAAAGGGACCTCCAGATAGGGTGTTCATCATTGGACCAGTGAAGGAAGTCA
GAAAGGCGGAGGCCATCCTGAGGGGCCGAATGCTGGAATTCTAGAGAAACGACTTTTGTGATATAGACTTGAACTGCCCTATCTTTTGAACATAAGGGAT
ACAGAAATGCATGTGGATCGCTGATCCGTGACAAGAATAAAAATAAGAGTTGGATTGGAGGCAGCTTCGAGTATCTTTAGCTTAATTATCTGA
page-top