Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig55
Contig Information
Length 314 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc13b04    rwhgc13b04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Histone H4.3; AltName: Full=HM4 >gi|886740|emb|CAA59110.1| histone 4 [Zea mays]
Score 229
Evalue 8.23395e-18
Total Hit Count 469
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig55
CCTCGTGCCGCAAGATCTTCCTCGAGAACGTCATCCGCGACGCCGTCACCTACACCGAGCACGCCCGCCGCAAGACCGTCACCGCCATGGACGTCGTCTA
CGCGCTCAAGCGCCAGGGCCGCACCCTCTACGGCTTCGGAGGCTAGATCCGTCTAGTGGAGCAACTTCCTCGTTTGCTCTGTGTGACATGTATCGTGCTA
GATGGGATTTACTGCTTTGGCGTGCGTCGTTGTGTTCTGTCCTTGGGTTCCAGTAGGCTGTGTAATACCTGTTCAATGCAATCAGTTCGATTCTGAATCC
TAACAAAAAAAAAA
page-top