Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig54
Contig Information
Length 225 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc10h05    rwhgc10h05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit NADH dehydrogenase subunit 4L [Oryza sativa Japonica Group] >gi|23495407|dbj|BAC19888.1| NADH dehydrogenase subunit 4L [Oryza sativa Japonica Group]
Score 142
Evalue 1.04121e-07
Total Hit Count 198
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig54
GTCAATTATTTGCTTTATTAGTTCTAACAGTGGCAGCTGCGGAATCTGCTATTGGATTAGCCATTTTCGTTATTACTTTTCGAGTCCGAGGGACTATTGC
TGTCGAATTTATAAATTGCATTCAAGGTTAAACATAACTACAGGAGAGTTACCAAATACAAAGTTCTGTTCTCCTTTCGTTCTCTTCTTTCTTTTCTTTA
AAAAAAAAAAAAACCAAAAAAAAAA
page-top