Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig53
Contig Information
Length 1297 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc13b01    rwhgc13b01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_12278 [Oryza sativa Indica Group]
Score 1406
Evalue 1.95517e-153
Total Hit Count 134
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig53
CCATCGCCATGGCGATCTCCTCCCACCTCCTCCTCCCGCTCCTCCTCGCGGCGGCGGCCGCCTCCACCTTCGCCGGCGCCAACGACCTGGTCGGCGAGCT
CCAATCCCTCCGCTCCCGCTCCCCCGCCGGCGTGATCCACCTCACCGACACCTCCGTCACCCGCTTCCTCTCCTCGCCGGCCCCGCGCCCCTACTCCGTC
CTCGTCTTCTTCGACGCCACCTCGCTCCACTCCAAGACCGACCTCCACCTCCCCCAGCTCCGCCGCGAGTTCGCGCTCCTCTCCGCCTCCTTCCACGCCA
ACAACCCCGACTCCTCCGACCTCTTCTTCGCCGACATCGAGTTCTCCGAGTCGCAGCACTCCTTCTCCCAGTTCGGCGTCAACTCCCTCCCCCACGTCCG
CCTCATCCGCCCGGAGCACTCCCGCCTCGCCGACTCGGAGCAGATGGACCAGTCCCACTTCTCCCGCCTCGCCGATTCCATGGTCGAGTTCGTGGAGGCC
CGCACCGGCCTCGAGGTCGGCCCCATCGTCCGCCCTCCTCTCGTCTCCCGCAACCAGATGATCCTGCTCGTCCTCCTGTTCCTGATCTCCATCCCGTTCG
GCATCAAGAGGATCATGGAAGGGGACACCCTGCTTCATGACCGCAAGCTTTGGATGGCCGGGGCGCTGTTCGTCTACTTCTTCAGCGTGTCAGGGGGCAT
GTACGGGATCATCAGGCATACGCCCATGTTCATCACGGACCGGGAGGATCCAAACAAGCTCGTCTTCTTCTACCAGGGTTCAGGGATGCAGCTCGGCGCA
GAGGGGTTTGCCGTTGGTTTCCTGTACACCCTCGTGGGGCTGATGATAGCTGTGGTGACACACTTGCTGGTGAAGGTGGAGAGCCTGCAGACACAGCGAT
TTGCGATGCTGGCAGTCATGGCCATCGGGTGGTGGGCAGTCAGGAAGGTGATTTACCTGGATAACTGGAAGACTGGGTACGGCATTCATACCTTCTGGCC
CAGTAGCTGGAGGTAAATGTTGTCTCAACCGGCGATCGATGCTTATTTCCTTTGGTTGCAGAGGACGTGGAGTCATCCATCCAGATCGACCATACTGAGA
TAGAGCATCATTTTGGTTGTAACGTCGTACTACCAAGTTTAGCATTTCAATTCTCTGGTGCTTTATTGTGGAATATAGAGAACCGAGTCATTTTATACCG
AGGATTTTAACTTGCAGTATTGCTTGAACATTGGTAAATCCTATTTAGCTGATATCTCTGATATCTCTTCTCAGGCAGTAACACCAGCCGAGGATAT
page-top