Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig49
Contig Information
Length 919 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc13a15    rwhgc13a15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_34181 [Oryza sativa Indica Group]
Score 754
Evalue 4.69796e-78
Total Hit Count 26
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig49
GGACACTGGCCGAGATGTCGATCTTGGACAAGACCTCACCGATTCTGAGGACAGCAAAGCATGCCAAGTGAAAGCTAAGCAACTGCGAGATCATGAGCTT
GATTTTCTGGTTGCCATATTGGGCTTGCTTGTCAATCTCGTGGAAAAAGATAGCCTTAATAGGGTGCGGCTTGCATCTGCCCGTGTTTCTGTGGATCTGT
CTAAGAACGCACAGAGTGAAAAGGCACAGAGGGATGTTATACCACTCCTCTGTTCAATCTTCTTAGCAAGTAAAGGTTCTGGGGAAGCTTCTGCAACTAT
ATCACCGGATGATGAAGAGTCAATGTTGCAAGGAGCACGGGAAGCTGAAATGATGATCGTGGAGGCCTATGCAGCCCTCGTGCTTGGCTTTCTTTCGATA
GAAAGCATGAAGGTTCGAGGAGCGATTTCCAGCTGCCTTCCAAATAACAACTTGAAAGTTCTTGTGCCTGTGCTAGAGAAATTTGTGGCGTTTCATCTGC
AGCTTAATATGATGACAGACGAAACACACTCATCTGTTACAGAAGTTATCGAAAAATGCAAACTATGATAGGATGGTGAAGAGGTCACCTGTATAGACTG
ACTGGCCTCTTCGCAGCCTAGGCACACACAAGTGTTCCTCCTCGTCCCCTCGTGCGCCGCAGATGACCTGCAGTCGTCTTGCAACTAACCAAGCATGGTG
TCATTCTTTCTTTTCTTTTCCTTTTGCCCCCCTGTTGTTGTCGCGCATCTTTTGTGTGTGCTCCTTGCCGCCTCTCAAAACACGTTGTTTACTTAGCCAA
TTCAAATTGAATGTAAAATAACATCATAGGGAATGTACTGTGTGTGCGTGTGTGTGTTTGTAATTTGTACTGGTACCAGTCATAGTCAGTCACCACACAT
GCCTAAATCTGAAGAAGCT
page-top