Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig47
Contig Information
Length 713 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc13a07    rwhgc13a07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_021765 [Oryza sativa (japonica cultivar-group)]
Score 559
Evalue 1.20055e-55
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig47
GAGGCAGCGGGTTGAAGATATGGTGCTGGAGACCACTCGGCAGAGGCAGCGCGCTGCTGAAAATGAGCAGGAGCTCAGTCGTGTGAAGAACGACTTTGAG
TCGCTCAGAACTTATGTGAGCACACTCGTTAGTGTCAGAGAAACTCTTCTTTCATCGGAGAAGCAATTCGAGACAATGGAGAAGCTTTTTGACAGGCTAG
TCGCAAGGACCAACCAGCTCGAGACTGAGAAAGCACAGAAAGAAGCTGAAGTCCAGAAGGTGATGGAGGAAAATGTGAGGCTACGTGCCATGGTCGACAA
GAAGGACGCACAGCTCCAGGCGATGAGTGAGCAGTGCAAGTTCATGGCTCTGAACCGTCCAAACTAGCGGAAGACAGATACACCAGATAAGAAACCTGCT
CTTGTCCAACTGATGTCACTTACAGTTACGTTGCCGCGGCAGTGAAAAGAAAAGGAAGTTATATCCCTGGGGGTCCAGAATAACCGACGATGATGCCATG
GTCCCGGGTCCGTGATTTGTGGTGCAAACCGAATCGTGAATTGTTGTTACCTTAGATGTGTTGTGTCGAAATTGCAACGATGAGACATTTGTTGTATCTT
GATTGTGTGTGTGAAGGCTGGGCGCATTTGTCCGGTTTTCGTAAATCATAGAGATGTATAACCGCAGTTCCATTCATCCTTCTGCCTGAACCATATAGTT
CAGCCGCTGTTTT
page-top