Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig46
Contig Information
Length 594 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc13a06    rwhgc13a06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0396900 [Oryza sativa (japonica cultivar-group)] >gi|46981322|gb|AAT07640.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113579016|dbj|BAF17379.1| Os05g0396900 [Oryza sativa (japonica cultivar-group)] >gi|125594156|gb|EAZ34215.1| hypothetical protein OsJ_017698 [Oryza sativa (japonica cultivar-group)] >gi|215697544|dbj|BAG91538.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215712354|dbj|BAG94481.1| unnamed protein product [Oryza sativa Japonica Group]
Score 672
Evalue 6.2502e-69
Total Hit Count 17
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig46
GAGCAGTGTCCGCGCATACGTTCAGGCCACTGAGTATGCCGCGCAGTTCTGGGCCGGCGTAATGGCTAAAGTGCGGTTGCGTGGGCTTGCCGTGCCAAGG
GTGTTCTACCGGACGACGGTTGCGACTGGCGGGTATGCTCGGGACCTGGCATTCAATCCAAACAAGATGGAGCTATTCAATGGCGTGCTCGTGGAGAAGA
TGAGGCAGCATGGCGTGCTCACAGGCGGGGTGATAGACAACTTCGACATGACGTTCCCATGGCACTACGACAACCGTTGCAACGACGGCGTGCACTACGG
GCGCGCACCGGCAAAGTTGGTATGGCGGGACGGCAAGATCGGTCACCAGTACTTCGTGGACCTCATGCTAGGGCATGTGCTCCTCAATGCCATCTGCAAT
GGATGAAACTCTGCTGGTTCCATGCTCGGTAAGTTTGTGCACAGCTCAATTGTGTAAACTAGGGTAGGATAGCCACGGAACTGAGGTTGCTGTGGTGAAA
TTGTGGTATCAGTTTATGTGTACCGCAGATATCGCGGGCATAGCTGAACCGTTTTATATGGTGAGACTGTCTGATCATTTAGCCAAAAAAAAAA
page-top