Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig44
Contig Information
Length 1103 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12p20    rwhgc12p20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_11073 [Oryza sativa Indica Group]
Score 660
Evalue 4.96323e-67
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig44
GGTTCTCGCCACGCAGCCGCTGCCGCCGCCACTCGCGTCGCGGGTTCAAGATGCCTCGCTATGATGACCGTTACGATCGCTACGATGACCGTTATGATCG
TTATGACGACCGTTTTGATCGCTATAATGACCGTTATGATCGGTATGACCGATATGGTGGCAACACCAAGTTGTACGTGGGCCATCTTTCTACGCACACC
CGGACCAAGGATGTTGAGTACCTTTTCGGCAGATATGGGAGAATACGATGTGTGGAGCTGAAGTATGATTATGGCTTTGTTGAGTTTAGCGATCCCCGGG
ATGCAGATGATGCAAGGTATGAGCTTGATGGCCAAGAGGTTGATGGGAGCCGCATCATTGTTGAGTTTGCAAGAGGGACCCCGCGTGGCCCAGGAGGTTC
CCGCGAGTACTTGGGCAGAGGACCCCCTCCTGGTTCTGGCCGCTGCTTTAACTGTGGGATTGATGGGCACTGGGCTCGTGATTGCAATGCTGGCGACTGG
AAAAATAAGTGCTATCACTGTGGAGAAAAGGGCCATATAGAAAAAAACTGCCAGAACAGTCCTAAGAATATCAACTTTTGCAAATACAGGCGGGGAAGAA
GCTACTCACGCTCCCCACCACCTCATCGCGAAAGGAGCCTAAGCAGGAGTTACAGCCGATCGCCTTATCCAAGGAGGGATGATCGAGCTGTTGGCCATGA
GGAAAGGCGACCAAGAAGCTCTAGTTACAGCCCTAGGAGGAGTGCTTCACCTTCCGGTTTGAACCGCAGCCCAGCACCAAATGGCAAGAGCCACCCACCA
AAGGAGCAAGCTGAAGTCAATGGTTCACATAACGGTGTGAGAGGCAACAGCCTGAGTCCCGCCCGTGATAGCCGCCCAGCCACCAACAGAATGAGCCCTA
GCCCCTGGGAGTGATGGCGAATGCTGCGCACCACCCTCAACTTGAACTAATCTTGTTGCATCGTCTCTTGGGCCGAACTCTTATGTTGGTAGACTATGTT
AGTATGTTTGTCGAACGTCGGTTCGCGTTATGCCTCCTCGTCTAAACCTGTCCGGGTCATGAATTTTTCATGATTGACAAATGTTGACGTGTGTTATGCC
GCC
page-top