Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig43
Contig Information
Length 715 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12h11    rwhgc12h11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0517800 [Oryza sativa (japonica cultivar-group)] >gi|46575961|gb|AAT01322.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113579605|dbj|BAF17968.1| Os05g0517800 [Oryza sativa (japonica cultivar-group)] >gi|125594893|gb|EAZ34952.1| hypothetical protein OsJ_018435 [Oryza sativa (japonica cultivar-group)]
Score 233
Evalue 7.67927e-18
Total Hit Count 35
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig43
CAGCGAACATCTCTCTGCTCCGACGCCGTCAGCAGGCCCTTTCTCGCCCCAAACTCCGGCGACGATCCACACCACGCGCTAGGGTTCTACAGAGAGGCGA
TGGCGTTGACCAACTTGATCCTGACGGTGGTGGGCGTGGGCGCGGCGGTGATGCTGCTGCGGAAGGACGTGAAGCAGTCGTCCGCCGTCTTCCGCCGCAA
CATTCGCCACATCAAGACCTGGCTCGAGGAGGAGTCCGCCGCCACCACATCTGCTGAGCGATCGGTACCCAAGGAGCTGGAGGCCCAGGCTGCCAAGAAG
GATTCCACACCCAAAGTGGACAAGGATTAGATGATTTTACACTGTTTCTATTCGATGCAACTGCGGGTTTAGGATTCACAAGAAGTACTTGTAAATAGAA
GATGTTTGGTAGGATCTTCACTCTAAAGAATATTGGAATCAAATAATTTGGGCATGTATGGATAGCTGCATGTGGGTTCTATATGTCTTCAGGTTGGTAA
TACTGAAACTCTACGGTTAAGATCAATCATCCTCTTGAATATAGGTTTTGTCTGGCAGTAATTTGTCAGCCACTTATGTTTCTTGTGGCACCATTCACCT
CCATTGTTTTTATGAAGTTATAGTGTGTTTCTTTTCTTGCATGTATGTGGTATTTACGTTANAAACATGTTTGAAATTATCACATATCAAGTCGTGCTTC
TTGTCAAAAAAAAAA
page-top