Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig41
Contig Information
Length 486 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12p08    rwhgc12p08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_35066 [Oryza sativa Indica Group]
Score 110
Evalue 0.000531693
Total Hit Count 41
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig41
CCTCGTGCCGCGAGGAAGATGTTTGGATCCATCAGTGAACTAGAGGAAAGGGACGGGTGCTTGTGGATTGGCTCGGTTCATTTGCCTTTTCTTGGGCATT
ACTGCCTATAGATAGATTGAGTGATGATATACAGAGTGCAAAGAGGGTGTGTCGTGTTGTCTCGTTTAGTCATATAGAGGAAATTAGATATTACCGTATT
AGGATACATTATTGTGTAGAAAAGGTATTGCCTAGACTTTAGTTTCTTTTTCATTTTTTTTGAAGTTGTGTCCCTTATAGCTTCACTTTATTGGGAGTGA
CTAGCATATAATCTGTACATGTGGTGCAAAAACTAGAAAAACTATTATAGGCCATCAGATCAAACATTAATGGTGCGGATTATAGTGGAGGCATCTCATG
CCACTAAATGTATATTTCATGGATAGTTAGATACTCCCTCCATTAAAGGCCACTATGAAATATACATTTTGCATCTAAAAAAAAAA
page-top