Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig40
Contig Information
Length 586 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12p07    rwhgc12p07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cbs domain protein [Oryza sativa (indica cultivar-group)]
Score 498
Evalue 9.11113e-49
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig40
GTTAAACCCGGGGAAGATAAATCAATTGCTGGCATCGTCACAGAGAGAGATTATCTCCGGAAAATCATAGTGCAGGGTCGATCCTCCAAGTCAACCAAAG
TTGGAGATATCATGACCGAAGAGAACAAGCTGATCACGGTGAAACCTGAAACCAGAGTCCTGAAAGCAATGCAGCTGATGACAGACAAGCGTATCAGGCA
CATCCCGGTGATCAGCGGCACCGAGATGATGGGGATGGTCTCCATCGGCGACGTGGTGCGCGCGGTGGTCAGCGAGCACAAGGAGGAGCTGAACCGGCTC
AACGCCTACATCCAGGGTGGGTACTAGGACCCCGCCGTTTTGCAGGGCGTCCCTTTGAGTGAACTCTACAATAACGACCAGGGTGATGATGACGAAATAG
GCCGTGTTTCTTCGCGGACAATGGCCGTTGAACTTGAATTTGCGTGTGTGATGTTTTCCTGCTTATTTAGTGTATATTTCTGTGGCGGCACTCGCCGCCG
CGCGCTTGTTTCTGGAGCGTATAGGCCATCTCAGCGGATGGTGATAGACGCAGAATAAAGCTTGGGAGTGTCCCGGAAAAAAAAAA
page-top