Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig34
Contig Information
Length 695 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12i12    rwhgc12i12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_000199 [Oryza sativa (japonica cultivar-group)]
Score 564
Evalue 2.98053e-56
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig34
GGTACTTGAAAAACACCGGGGTCCTATTACTACCATACATTATTCGCCGGATGTTTCCATGTTTTGTTCTGCTGATTCCAACAGGGAAGCTGTTGCATGG
GATCGGGCAACTAGAGAGGTGAAAGTGAAGAACATGCTGTTCCACACGGCTCGGGTAAACTGCCTGGCGTGGTCACCCGACAGCCGTTTCGTGGCCACGG
GGTCGCTGGACACCTGCGCGATCATCTACGACGTAGACAAGCCAGCGGCCAGCCGCACCACCATCAAGGGAGCGCACCTCGGCGGGGTCCACGGGATCTC
CTTCGCCGACAACGACACCCTGGTGACCGCCGGCGAGGACGCATGCATCCGCGTCTGGAAACTGACGCACCAGTAGGCGCTCTCATCGGTCGCTGTTTTC
CGCGGGCCGCGCTGTCTAGTCTGTTTTTTTTCTCTCTCTCTGTGATGTGATTCTTTCGTGTGCTCCTGGAAGAAAGAACCCTACTGTCATCGTTTCCTTC
CCACGCGTCGTCGTCTGGTTTTGTGGGGTGCTGAGAATACAGGGGATGCTGGCGTGTTGTGATATCTGTCTCTGTGCTCTTCTCCCTGGAGTGGTTATAT
TTTTTTTTCTGTGTTTGCCCCCTGCACTGGTTGTTAATAACTGAGACAATATCTGTACTTGCGTTTTCATGAAATCATCATACNCATGTGCTTTG
page-top