Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig33
Contig Information
Length 502 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12m12    rwhgc12m12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein l22-2 [Oryza sativa (indica cultivar-group)]
Score 184
Evalue 1.48974e-12
Total Hit Count 233
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig33
GAAGAGAGAGAGCGGGGCGNGNGCCAGGCAGTCGACGGCGACGTCGTCCGGCATGCCCGGGATGAGGTCGATGTGCTCGACCTTGCACTCCTGAACACGG
CTCTTCTGGTTCCTCATCTTCGTTATCTCTGGGATTGGGATTTGGGATTGGGGCACAACGTGCGGGACTGGCTTCGCGTGATCGCAGCCAACAAGGAGCG
CAACGTGTACGAGCTCCGGTACTTCAACATCGCTGAGAATGAGGGCGAGGAGGAGGATTAGAGTGCATTGTTATATTGTAGTGCTTGTTGAGTTTTGATA
CTTGATCTGAGTACCTCCTAGTTATCCACCTATCTTATGTTGTGCCCCTTTGAACATGGATGGTTTAATTCGAAGAATCCTTATATTTTGTCTGCTGTGT
ATCCATATGTCTGAACCTAATAGACGAGTATTATGGAGATTTGTTCCTGTTTCCACCGAACTGCGGTGCGAAGCAGTGGTGCTTTTCACTCCAAAAAAAA
AA
page-top