Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig31
Contig Information
Length 648 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12m02    rwhgc12m02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit H0525C06.2 [Oryza sativa (indica cultivar-group)]
Score 281
Evalue 1.71235e-23
Total Hit Count 419
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig31
GTTATAGCACAACCAATGCTACCCCCACCAATGAGGGATGTTCCCATGCAAATGCCATATCCTGAGATGGTTTACATGCCACCACCACCACCACCACTGG
GAGTACCTATGATGGCTCCTCCTCTCTCGCCTCCTAGAGGTTTTGCTGATAACAAGAGCACAGTGGAAGTTTGCAGGGACTACTTGAAGAAAATGTGCAA
TAGAGAATCATGTAGATTTGCACACCCTGATTCACAAACTGAGGTGGCACATGACAAGGTTGAAGTTTGCCGTGATTTTAAACGAGGAGAATGCACTCGA
CCTACATGCCGCTTTTACCACCCATCCTCAAGCTGAAGTTCTGTTAGATAAATCTTTCATGCCCCGCTCTGCTGCTGCTGCCGCCGCCGCTGCTGCTAAT
CCTGCTACCGCTGCGAAAGAGCTGCTGCGCTGGCTGTTATGATGCTAAGGTGCCATAGAGTATGAGACCGTCGCAAGTGCTATGTCTCTGGAAGGAAAAC
AAAACTTGTTACTATCGTGTGATGTTCAGATGGTTTGCTTGAACTTGACTCAGCTCCGAAGTAGTCTTCTTCACAATGGACTTTGCATGTGCGGTTGGTG
TATTTGCGTTCATAAAGATGTTTTAGACTTTTCGCTGCAAAAAAAAAA
page-top