Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig30
Contig Information
Length 851 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12n15    rwhgc12n15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_028684 [Oryza sativa (japonica cultivar-group)]
Score 398
Evalue 7.85402e-37
Total Hit Count 11
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig30
TTCTCCTCTCGCAAGCCCTAGAAGCCATGGTCCGTGGAGGCCGCAGGTGACCGCCGCCGGTAGCAAGAGGCGCCAGGAGGAGTGGTGGCGGTTGTTGAGG
CGCGGCAAGATGTCGGTGCGGATAAAGGCGGTGGTGGACAGGTTCGTGAAGGAGCTCAAGGAGGCGCTGGACGCGGACATCCAAGACCGCGTCATGAGGG
AGCGCGAGATGCAGAGCTACATCGAGGAGCGCGAGCGCGAGGTCGCCGAGCGGGAGGCCGCGTGGAAGGCCGAGCTCTCCCGCCGCGAGGCTGAAATTGC
ACGGCAAGAGGCAAGGCTTAAAATGGAAAGGGAGAATCTGGAGAAAGAAAAGAGTGTCCTGATGGGAACTGCTTCGAATCAGGATAACCAAGACGGAGCC
CTTGAGATCACAGTTAGCGGTGAGAAGTATAGGTGCCTGCGCTTCTCCAAGGCGAAGAAGTGAGGTATGAGCTAGGGTGGCACCTGTAGTACACCGTTAT
TTTAAGCCTTGCACCTGATCCAAATTGGAGCAGCACAAGAAATCCCCATGTGTCCCCTACCAAGTAAAGGATTCTCCTTTGATCTGTTTGTTAGGCACCG
CTGCCTCCTTCCTGTTCCCAAATAATCAGGTGATTGAACGCCACATGAGATGATGCCTGCCTGCCTGCCGAACGAGTGCAGTAACATGAATGGCTTCCAA
TTATCATCACAGTACAGGAGCCATGTTAGGTCCAGCTTCTGATTGCCAGCGTCGGTTCACTTCGAAAAAACAATTAAGGAGGTTGCTTTTCTTTTCTCTT
CCCTTCAGAACTCGGGGCTGGAGCTATCTGTTCTTGTCCCAGTCGATAAAT
page-top