Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig29
Contig Information
Length 933 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12l24    rwhgc12l24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0436000 [Oryza sativa (japonica cultivar-group)] >gi|42407521|dbj|BAD10638.1| putative polypyrimidine tract-binding protein homolog [Oryza sativa Japonica Group] >gi|113623854|dbj|BAF23799.1| Os08g0436000 [Oryza sativa (japonica cultivar-group)] >gi|215695278|dbj|BAG90469.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1076
Evalue 2.20729e-115
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig29
ATCACATCGCAGCAGGGATTACACAAATCCTTATCTTCCTGTTAATCCAACTGCAATCGAGGGAATCGCACAGCCCATATTAGGCTCTGATGGGAAGATT
AAGGAGCCAGAGAGCAATGTACTTTTAGCATCAATCGAGAACATGCAGTATGCTGTGGGAGTGGATGTTCTACACACTGTGTTCTCTTCTTTTGGTGCTG
TCCGAAAGATTGCAATGTTCGAGAAGAATGGTGGAATGCAGGCTCTAATTCAGTATCCAGATATAACAACAGCAGGAGTTGCTAAACAAGCTCTGGAGGG
ACATTGCATATATGATGGTGGTTACTGTAAGCTTCATCTGTCATACTCTCGTCATACTGATCTGAATGTGAAGGCACATGACGAGAGAAGCAGAGATTAC
ACCGTCTCGGATCCTAGTGCTCAGGTACAAGCTGCAGGTCAAGCCCCTGGTCTAAGCACAACTGGAGCAGCATGGCAAAGCACCACGCCTGCTGCTTTTT
ATGGAAGCTCAGCAGGAGCGACCTCTATCGGACAAGTGCCAGCCTGGAATCCTAACATGCAGCGAGGGGCGTTTGCACCTGCATCAACCTCGTACCCTAC
CCAATTATTGATGGCAAACCCAGGCCCGCACTTTCCAGCAGTCGGATCAAGCTCTGGTGCTCCTCCGATGTTGTACCAAGCTTCACAGCAGATGGCACAA
TATGGCACAGCCCCTACTGCTCTGCCTCATGCAGCCTTGTCTGGCGAACCGATGTACTTCCCAAAATGAGCTATTCATCCGATAGAGCAGTTGCCTATGC
TTTGTGCAGCACCTCTGGTCTTCAATTTTTGGAACTGCACTGTAATGCCGATCTGTTTTTCTTGGTACTTGTGAGACCCCTGTGGCAAATGTACCTGTCT
GGCTGTTGGTGCCTGTAAACTGCACAGCAAAAT
page-top