Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig27
Contig Information
Length 961 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12n10    rwhgc12n10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0236000 [Oryza sativa (japonica cultivar-group)] >gi|50251688|dbj|BAD27593.1| putative aspartate transaminase [Oryza sativa Japonica Group] >gi|113535919|dbj|BAF08302.1| Os02g0236000 [Oryza sativa (japonica cultivar-group)] >gi|215697838|dbj|BAG92031.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1217
Evalue 1.03172e-131
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig27
ATTGATGGATGATATCAAGAATGCTCCAAATGGTTCGTTCTTTTTGCTTCATGCATGTGCCCATAATCCTACTGGAGTAGATCCTACTGAGGAACAATGG
CGAGAAATATCCTATCAGTTCAAGTTGAAGAATCATTTCCCATTTTTTGACATGGCATACCAAGGATTTGCTAGCGGTGATCCAGAGAGAGATGCCAAGG
CAATCCGTATATTCCTTGAAGACGGACACCAAATTGGATGTGCTCAGTCATATGCAAAGAACATGGGTCTTTATGGCCAGAGAGCGGGATGTCTGAGTAT
CCTCTGCGAGGATGAGATGCAAGCAGTTGCTGTTAAGAGCCAATTGCAACAGATTGCGAGACCAATGTACAGCAACCCACCTGTTCATGGTGCATTGGTT
GTTTCAATTATCCTTAGTGATCCAGAATTGAAGAATGTATGGTTGGGAGAGGTCAAGGGTATGGCTGATCGTATCATTGGAATGCGGAAGGCACTTCGGG
AGAATCTTGAAAAGTTAGGTTCACCTTTATCATGGGAGCATGTCACCAATCAGATTGGAATGTTTTGCTACAGTGGGATGACACCGGAACAAGTCGATCG
CCTGACAAGTGAATACCATATCTACATGACACGCAACGGGAGAATAAGCATGGCCGGTGTAACGACGGGCAACGTCGCCTACTTAGCTAACGCCATTCAT
GATGTTACCAAGTCAAATTGAGGACCATCTTCAGCGAATGGAGGCGTCGCCTACTTGGCTAACGCCATTCATGATGTTACCAAGTGAAATTGAGGACCAT
CTTCAGCGAATGGAGGGAGAGCGTTTTCCCTTTGTTTGTAGGGCTATTCGCTTTATACTGTCACATGCTAGAGAAATAAGTTCTAGGAAGTAAACCTGTT
GCGGCTGTCCAACAACGGAAAATTCTACCTGTATGTATGGAGGAGCAGAGACGTCCTGACT
page-top