Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig26
Contig Information
Length 871 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12l23    rwhgc12l23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit expressed protein [Oryza sativa (japonica cultivar-group)] >gi|215692397|dbj|BAG87817.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215766576|dbj|BAG98735.1| unnamed protein product [Oryza sativa Japonica Group]
Score 265
Evalue 2.14929e-21
Total Hit Count 20
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig26
GTCCACACTGGAAGCCACAGTCCACTCTGCTTCCCCCCTAAAACAAATCATCTCCCGCTGACTCTGCACGTTGCGTCAGATCTCTAGCTCGTGTCAACTC
TGAATACCCATGCTACATGTTTGTTTGACCTTGCAAAGTGGAGCAGGAGCTGGGGGGGGCATGAAGTTGATCCGCAGGGGCAAGCGTTCAAGGGCGAAGA
AGGGCTCGTCGGCCCCGTTGCAATCTACCGGAGATGTTGATGGTGGAAGCGGGGGTGGCTCCAATAGCAGGCAAGTGGCGCCTGAGAACGTCCTCCCGGC
TGAATCGGCTACAATCGCTGGCTATGGTAGCAGCAGAGATGAAGCTTTCTACGAAGCCTCTCCTTGGTTAGACTCGGACTGTGAAGACGATTTCTTCAGT
GTAAATGGAGATGGTACACCTGCGAGAACATTCAGCACAACTGCAAGCAACCAGGCCACAGCTGCTGCATTTGAACCTCGGACAAAGCTGCCCACGCTGG
AGGCGATCCTCAAATCCGATCCCCTGAAGCCAGCCCCACAGACGAAGAAGCTCGGTGACCTCCTTAAGGAGAAGCAAGAAAGCGCCGATGGCGCCGGCGA
CATCTCCGGGGCTCGCGGCGGAGGCAGAGCTGGGCGGTGCTGCATCCCTCAGTTGTCGCGGGTCATCAGCCACAGGGAGAGGAGAAATTAAGGGCAAGTG
ACAAGACAAGACTGGGGATGAGGCGAGACCATGGATGGCAAGTCGATCTGGGTTTGTTGAGACCGATCAGTTTAAATTCCTGCCGGAGTGTATAATTTCA
GATTGCCTTATGGAGCAGTCGCAACAAACAATTTAGCCGTCTAAATGTATATACACAAGCGTGCCACATAC
page-top