Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig25
Contig Information
Length 808 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12k21    rwhgc12k21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit MIKC-type MADS-box transcription factor WM14 [Triticum aestivum]
Score 996
Evalue 3.23949e-106
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig25
GGCAGATCGAGATCAGAGGATCGAGAACTCGTCCACCGCCAGGTGACCTTCGCCAAGCGCCGGGCCGGGCTGGTGAAGAAGGCCCGCGAGATCGGCGTGC
TCTGCGACGCCGAGGTCGGCGTCGTCATCTTCTCCAGCGCCGGCAAGCTCTACGACTTCTGGACGCCCAAGACCACGCTGCCAAGGATCTTGGAGAAGTA
CCAGACCAACTCCGGGAAGATCCTGTGGGACGAGAAGCACAAGAGCATCAGCGCGGAGATTGACAGGGTGAAGAAGGAGAACGACAACATGCAGATCGAG
CTCAGGCATATGAAAGGCGAGGATGTGAACTCGCTGCAGCCCAAGGAGCTGATCGCCATCGAGGAGGCGCTCACCAACGGCCAGACCAGCCTCAGGGACA
AGATGATGGACCACTGGAAGATGCACAGGAGGAATGAGAAGATGCTGGAGGAGGAGCACAAGCTGCTGGCTTTGAGGATGCACCAGCAGGACGACCTGAG
CAGCAACATGAGGGAGATGGAGCTCGGGTACCATCAGGGTAGGGATTTCACTTCCCAGATGCCGTTCACCTTCCGGCTGCAGCCCAGCCACCCCAACTTG
CAGGAAGACAAGTAGGCCAACGAATCCTGCCACGGCCTGTGTGAACTGAAGCTCCTCTACCTGCAGGCCACAACTGCTACCTTCAATTTCCTTGTGAAAC
CTTAAATGTATCTTCCTTTTCATGTCTGGCTTGATGAACTTAACAGCGCTAGTTGGTTCCCAACACATAACCTTTAACTAAGACAGTTCCTGTCCCTGCC
AAGATGCT
page-top