Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig22
Contig Information
Length 759 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12l22    rwhgc12l22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0708900 [Oryza sativa (japonica cultivar-group)] >gi|113533561|dbj|BAF05944.1| Os01g0708900 [Oryza sativa (japonica cultivar-group)]
Score 767
Evalue 1.03715e-79
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig22
CCATCATATGGAGGAATAAAAGATGTCTTCAGAGGTGTTTACTCAGAGGGTGGAGTGCGAGCGCTGTATCGTGGAGTAGGTCCAACGCTAATGGGAATAC
TTCCCTATGCTGGTCTTAAATTCTACATATATGAAGGGTTGAAGGCACACGTACCTGAAGATTACAAAAATTCTGTCACTTTAAAACTATCCTGTGGTGC
CGCAGCTGGTTTATTTGGACAAACTTTAACCTACCCACTAGATGTAGTCAGGAGACAAATGCAGGTTCAAAGTCATCTGCAGCATGATCAGTCTGGCGGC
CCACGAATAACAGGTACATTCCAGGGGCTTAAGATCATCAAACAAACACAGGGATGGAGACAATTATTTGCTGGTCTGAGCCTCAATTATATCAAGGTGG
TACCCTCGGTGGCTATTGGTTTCACCGCATACGACACAATGAAGCATTTGCTGAAGATACCTCCGAGAGAGAGCATAAAGCCTGAGCAAGGTTCTGGTTG
AAGCTTCTATCCACAAAAGAAGGCACATCTATGAAGTGCCAGTTGGAGGCTTCAAGCCTCATCAAGTCCATGATTGTTATTCTCCCTCCGTAAAGGAATA
TAAGAGCATTTAGATCACTACTATAGTGATCTAAACACTCTTATATTTCTTTACAGAGGGAGTACGTAGTAATTGTGTTGCGTACTTACCCCAGCTGACA
TATTCTTTTCGTTATATTTTTTCGAATTCATTTTTATTTTTTCACCAACATGTATACTT
page-top