Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig20
Contig Information
Length 735 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc10j04    rwhgc10j04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit immature spike ubiquitin-conjugating enzyme 2 [Triticum aestivum]
Score 798
Evalue 2.49659e-83
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig20
CACCTCCGCCCCCGATCCCTCCCGCCTTTCCCCCTCGCCGCCCCTCCTTCGATTCCGTCAGATCGGCGCCAGTAACGCCGGGGTCCGATCCCGATCTGTC
TCCTTCCCGACCTTCGCGAGCTTATCATGGCTTCAAAACGTATCCTGAAGGAACTGAAGGACTTGCAGAAAGATCCTCCGACATCATGCAGTGCAGGTCC
TTCTGGCGAGGATATGTTCCATTGGCAGGCAACAATTATGGGTCCTCCTGATAGTCCCTATGCTGGAGGTGTTTTCTTAGTGAATATCCATTTCCCCCCG
GACTACCCCTTCAAGCCTCCGAAGGTATCGTTCAAGACAAAGGTCTTCCATCCGAACATCAATAGCAATGGAAGCATATGCCTCGACATTCTGAAGGAGC
AATGGAGTCCTGCTTTGACAATCTCTAAGGTTCTGCTTTCAATCTGCTCGCTGCTTACCGACCCTAACCCGGACGACCCTCTCGTCCCCGAGATTGCCCA
CATGTACAAGACGGATCGGTCCAAGTATGAGACGACAGCCCGCAGCTGGACGCAGAAGTATGCCATGGGATGATACGAAGCCCATGCTCGTATCCACTGC
TTGCATGCAGAAGATTGTGTTGCTGTCCTGAGAAACTATCTCTGGGCCATTATTTTCTTTGATTACTTGTCGGTCGCGTGTGTCTCCCTGATCCATGTAG
GATCGCGTCGTAGTCAAAACATCAACCTATCATTG
page-top