Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig18
Contig Information
Length 914 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12j17    rwhgc12j17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_22903 [Oryza sativa Indica Group]
Score 603
Evalue 1.65733e-92
Total Hit Count 403
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig18
TGCAGATCTCCTCGTTTGTCAAAGATTTTTCCATGGGCTGGGACATTTCCTCTTCCATCAGTTGTGAGGAAACTTACTGAAACAGTGTGGCAGAAGATAA
GCGACCCAAGAAGTATACAGAAGATACTCAGGCAAGTATATGCTGACCACTCAACAAATGTTGACAAGGTGTTCTCGCGTATTATAGAGACAACAGAACA
CCCCGGCAGCTGCTGCATCATTTGCCTCCATTATGTTTGCTCCAATGGGCCAGATATCCTTTCAGGAGGCACTGTCTAGGTGCCAAAGGCAGGACATTCC
CATTTCCCTTATGTATGGGAAAGAAGACCCGTGGGTTACACCTTATTGGGGTATCAGAGTCAAGCAACAGGTGCCAGAAGCACCCTATTATGAAATTAGC
CCTGCCGGTCACTGTCCTCACGACGAGGTTCCTGAGGTTATAAACTATTTGCTCCGAGGATGGCTTAAGAATGTGGAGTCTGAGGGTTCAGTTGACCTCC
CATTTCTTGAAGATTCCAGCTTTCAAGAACATGGTGTGTCGAAGGAGCTGGAGTTTGTCAGGACAGGGTCCAAGAAATCAGTTAGTGTGCGGCTCTTCGG
TTCCCAAATTTCCCTGTGGAGCCAACTGAGCTCATTCTTGAAGCGGCATGCCTCCAACATAAGGGTAGTGTCCAGATGATTCGTCCGTAGTTCGTTAGAT
AGTAGAAGCTTCAATTGTATATTGTATTCATTATTCTTTATGTAAAGTAGTCAGGTTGATGCCTAGATGTACGAAATAGAGACAAGTTCAAATATTTTAG
TGAATGTGAATATGTGTAGTACAGAGTTAGCATTGGGCGTCAAACATCTGTCGTGGTTGTATTCATAGGAATTCAAGATCACATATTTTCCTGCTCGGTG
AATACCTGTAAAGT
page-top