Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig14
Contig Information
Length 462 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12l03    rwhgc12l03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RNA polymerase II elongator complex subunit Elp4 (predicted) [Schizosaccharomyces pombe] >gi|74625854|sp|Q9USP1|ELP4_SCHPO RecName: Full=Elongator complex protein 4 >gi|6016994|emb|CAB57848.1| RNA polymerase II elongator complex subunit Elp4 (predicted) [Schizosaccharomyces pombe]
Score 74
Evalue 7.77614
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig14
AGGATTTCGAGTGTGAAGGACACTCTGGAGGAGATTGACATGGAGATGGAGGAGCTGGAGTCCAGCGTGAAGATAGTGGATGAGATGATGCAGCTGTTAG
CGACCGCGCCGTGGTAGCAGTGTGCGCGCAGCTTCGGTCTCCGCCGCAGACAATAAATATTTTGGGCGACATGGCCGTTCAGTATACAGAAGATTAGAAC
TGCATTTTGGCGGCAGTATTTCATTTTTGTTTAAATGCAACTTGAGAGTAGTTATTATCTGTGTGCCATCTAGGCACTTCTTGTGCAGCAAACAAACTAG
GATGCTGTTTTTTTTGGGGTACACATCAAGTGGTGTGACCTATCTCCATCCCATCCCATCCCCCCTGTGTAATTCCGCGGAACTGCACCTGTGACCAGTG
CTGAAATGAAAATGCAAGAGATGCAGTTTGCTTTTGAGTATTTGTTGAGTGCAAAAAAAAAA
page-top