Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig5
Contig Information
Length 707 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhgc1e03   
Homology (BLAST) Top Hit hypothetical protein OsI_38206 [Oryza sativa Indica Group]
Score 722
Evalue 1.47972e-74
Total Hit Count 56
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig5
TGATTGGATGGGTAAGAGAGTCAGTTCACTGGCAGTTCTACATTATTCTGTACACAACATTGCTTCCATGAGTCAGCAGCTCTGACGACGTCTTATAACC
AAACGATCAATGGAGAGGTGAGAAAGGGGCAACGTCTTATCACCATGAAAGGTAGCACACCGATACCAACATCTTCGTTTAGTGCAGTTTCTAACAAAGA
TCTTCAGTTCAGTGAGTACGAATGTCCACTACTCAATGCCCTCCGAAGAACGTCGGCGTTCCACCCGAATACGGAATCAGAAGAGCTGGGGACCAAAATC
TCATGATTGAATATTCTGTCGGAGATTGGAGGAATATGGTCTTTTTTCTCATTGGCGTAGTTAATGATCTGGAACAGGACTTCTTGGATCAGCAAGCTTA
GCGCATCACGTCTTGAGCTGGTCTCTTCCAATGCTTGTCCTTTAGTATTTGCCGGTGCTTTGGAGCCACGTGATTTGCCTTGCCCTTTAGGGCTTGTGAC
ATGCAAATTGATGAACCATTGTTCCCAGAAAACCCTCTCAGTCTTGCTGCTGAACCAGCCTGGGTGCTTGTTCTTCTCATCGAAGAAAGAGAGGCACACC
TGGCTTTTCCGATTTGGATGCTTTTCTGACCAAGCAATGAACTGGTTGATCTTTTCATCAACCTCCTTTTCTAGTTCTGCAAGTCCACATTGAACATATG
TGATCTC
page-top