Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig4
Contig Information
Length 732 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whgc18n02   
Homology (BLAST) Top Hit hypothetical protein OsI_34040 [Oryza sativa Indica Group]
Score 571
Evalue 5.19607e-57
Total Hit Count 104
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig4
CCATTGTGAGAGGAGGAGAGAAGAGGAAGGGGCAGATCTATGGGCAACTGCAAGAGTTCATCTCGTGCACGCCTAGGAAAGGCCCATGTCGTTCCGGATT
CAGAATGGAGGATGCAGGACTTTGGAAAGACCCATGTTCCTGATTTAGAATGGAGGATTAATGACTTCTCATCGCTGCTTGAGACAGGAGCTAAGTCAGC
AAAATCTGACGCTTTTCACTGCTCTGGGTATAACTGGTACCTGCAAGTGAGTCCAATGCATAAGGAAACTGGTTCTGAAACGCCATATGTTGCTCTTTGT
CTTAAGACATCCCAACCAAGCATGGTGCCAGGTCACACGGTGCATGTGGTTTTTGAGTTGTCAATATACAACCATACAAAAGGAATGTACTGTGGTTGCA
AAGATACCTACAACTTTCATTTCAAGAATACCTACTCGAAGGAGCAATGCTTGATTCCTCTTCAGGAGCTACTGAAATCATCTGCTTTTCTAGTTGATGA
TAGCTGTGTCTTCGGTGTGGAGATATTAAAAATTGATGTCTCTTCTCCTGAAAAGAAGGCTGTTGTGGTTCAGAAGAAGGATACCACAGTTCAGAACCTC
TTTGTTCAGAAGAAGGGGTTCGTCAAAGGGACATACACTTGGAACATGAACAATTTCCTTGAACTGGACTCGGATCACTTCGTTCGTTCTCCTACATTTG
AAGTTGGCGGGCATAAATGGTACGTCTGCATC
page-top