Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig3
Contig Information
Length 704 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhgc3h12   
Homology (BLAST) Top Hit unnamed protein product [Vitis vinifera]
Score 440
Evalue 7.34094e-42
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig3
ACATTTGTCAAACATGAAAAATTCATGACTCAGACAGGTTTGACAGGTTTAGACGAGGAGGCATAACGCGAACCGACGTTCGACAAACATACTAACATAG
TCTACAAACATAAGAGTTCGGCCCAAGAGACGATGCAACAGGATTAATTCAAGTTGAGGGTGGTGTGCAGCGTTCACCATCACTCCCAGGGGCGGCTATC
GCGGGCAGGACTCAGGCTGTTGCCTCTCACACCGTTATGTGAACCATTGACTTCAGCTTGCTCCCTTGGTGGGTGGCTCTTGCCATTTGGTGCTGGGCTG
CGGTTCAAACCGGAAGGTGAAGCACTCCTCCTAGGGCTGTAACTAGAGCTTCTTGGTCGCCTTTCCTCGTGGCCAACAGCACGATCATCCCTCCTTGGAT
AAGGCGATCGGCTGTAACTCCTGCTTAGGCTCCTTTCGCGATGAGGTGGTGGGGAGCGTGAGTAGCTTCTTCCCCGCTTGAGATTCTTAGGACTGTTTTG
GCAGTTTTTTTCTATATGGCCCTTTTCTCCACAGCGATAGCACTTATTTTTCCAGTCGCCAGCATTGCAGTCACGAGCCCAGTGCCCATCAATCCCACAG
TTAAAGCAGCGGCCAGAACCAGGAGGGGGTCCTCTGCCCAAGTACTCGCGGGAACCTCCTGGGGCCACGCGGGATCCCTCTTGCAACTCAACAATGATAC
GGCT
page-top