Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1
Contig Information
Length 673 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whgc2k13   
Homology (BLAST) Top Hit caleosin 2 [Hordeum vulgare] >gi|34538479|gb|AAQ74240.1| caleosin 2 [Hordeum vulgare]
Score 934
Evalue 3.47421e-99
Total Hit Count 149
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1
TCCGCAACGCACGGTGTGATACAGAGAGAGCGATCGAGCCGAGCGCCATGGCGGAGGAGGCTAGGGCGGTCAGGGAAGAAGAGCTGTCGTCGGTGGCCGA
GGGGGCTCCCGTGACGGCCCGGCGGCCCGTCCGAGCAGACCTGGAGAAGCACATCCCAAAGCCCTACCTGGCCCGAGCTCTGGTGGCGCCGGACGTGTAC
CATCCTGGAGGGAGCAAGGAGGGCGGTCACCAGCACCAGCAGAGGAGCGTGCTGCAGCAGCATGTCGCCTTCTTCGACATGGATGGCGACGGCGTCATCT
ATCCATGGGAAACTTACCGAGGACTGAGGGCACTGGGCTTCAACATGATCGTGTCCGTCCTCATCGCAATAGGCATACATACTACTCTGAGCTACACAAC
TCTGCCTAGCTGGGTACCATCTCTGCTGTTCCCAATCTACATCGACAACATCCACAGGGCCAAACATGGCAGCGACACCGCGACTTATGACTCCNAGGGA
AGGTACATGCCGGTGAACTTCGAGAACATATTCAGCAAGAACGCCCGCTCGTCGCCGGATAAGCTAACGTTCCGGGAGATCTGGATGATGACCGACGGCC
AACGGCAGGCGAACGACCCATTTGGATGGGTGGCGAGCAAGGGGGAGTGGATGCTGCTGTACATGCTCGCCAA
page-top