Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig10
Contig Information
Length 687 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whgc16e13   
Homology (BLAST) Top Hit hypothetical protein OsJ_019314 [Oryza sativa (japonica cultivar-group)]
Score 460
Evalue 9.99749e-75
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig10
TTGTCTTGGTTCTGCAATGGGGGTGAGGTGCCTGCTGCTCCTGGCTGTGCTCCTCTTGGCTGGGGATCATGGCGGGGAGGCGCAGCCGCTCGTGCCCGGG
GTCTTCACGTTCGGCGACTCGTCGGTGGATATAGGTAACAACGACTACCTCCACACCCTCATCAAGGCGGACTTCCCTCCCTACGGCAGGGACTTCCCCA
ACCGCGTGGCCACCGGGAGGTTTTGCAACGGCAAGCTGGCCACCGACATCACTGGTCAGTTTGTACACTCTCTCTTGCTCCTTGTTAATATGTGTTCTTC
AGCATCTACGTACATGGTGGTGCAGTATTATGATTGCACTTGCTGATGTATCAATTTTTACGACTTGCGTGGTTGCACCTGATACACTGGGGTTCACGAG
CTACCCGCCCGCGTATCTCAGCCCGCAGGCGTCAGGGAAGAACCTTCTGATCGGCGCCAACTTCGCATCTGCTGGATCAGGCTACTACGATCACACCGCG
CTTATGTATCATGCCATCCCTTTCTCCCAACAACTGGAGTACTTCAGGGAGTACCAATCCAAGCTGACGGCGTTCGCTGGGAGCAGCCAGGCCAAGTCCA
TCATCANTGGCTCATTGTACATCGTCANCTTCGGTGCAAGTGACTTTGTGCAGAACTACTACATCAACCCTCTGCTCTTCAAGACCC
page-top