Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig2171
Contig Information
Length 1078 bp
Tissue Dormant seed with water absorption after breaking
Clones 22 Clones [Download: CSV  ,  FASTA ]
whei2a14    whei4i01    whei4i11    whei7a17    whei7a23    whei8e03    whei8o23    whei11j07    whei12b08    whei12b19    whei19o04    whei19o11    rwhei4i11    rwhei7a17    rwhei7a23    rwhei8o23    rwhei10c20    rwhei11j07    rwhei12b08    rwhei12b19    rwhei19o04    rwhei19o11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cation transport protein chaC [Zea mays] >gi|195630483|gb|ACG36635.1| cation transport protein chaC [Zea mays]
Score 994
Evalue 8.9319e-106
Total Hit Count 441
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig2171
TCCGTCCGGTCCGTCCCGGGGAAGAAGACCGCCGGCGGAGGAGAGGAGACGCGGGCGAGGCAAGAGGAGAGTCAAATCCCCATCTTGCTCCCCCCCCCGC
GCCGCCGACCCCACCCGCGGCATTCTCTCCGGCGTCCCTCCTCCGGCCAGGGGGAAAAGCAGCAGCAGGATGGTGCTGTGGGTCTTCGGGTATGGGTCCC
TGATCTGGAACCCCGGATTCGACTTCGACGAGAAGATCCTGGGATTCATCAAGGGATACAAGCGAACGTTTAATCTTGCTTGCATTGACCATAGAGGCAC
ACCACAGCATCCGGCCAGGACCTGCACCCTTGAATCCGAAGATGAAGCCATATGCTGGGGAATTGCTTATTGTGTCAAAGGTGGTCTAGAAAAAGAGCGA
GAAGCAATGCAGTACTTGGAGAGAAGAGAATGCGAGTATGACCAGAAGATCTCTGTGGATTTCTACAAGGATGGAAATTCTCTGGAACCAGCTGTGACGG
ATGTATTAGTTTTCGTATCCACTCCTGATCCAGTTGGCAACAAATACTATCTTGGCCCTGCTGCTTTGGAGGATATGGCAAGGCAAATTGCTACAGCCAG
TGGCCCTAATGGATATAATAGGGACTACCTGTTCTCAATGGAGAAGGCACTGTCCAATATAAGCCATGAAGACGACTCGATCATTGTGCTTGCGGATGAG
GTGAGGAAGGTGCTGAGCAGGTCGACGGAGAAGAAGGTTACCGGCTCCGACATACCATTAAAATCGCATACACCTGTTGTGCACATCTCTGCTCTTCCTG
AGGGCACCGTTGCGGTTTCAACATAGTAAGAAGAGCAGCACGGCTGGATCAGCGAAAGAGATGGCATTTTCCTCTGACCACACTCACTCTTGACATTCTA
CCATTGAAAGATCTGTGGTTTACTTCAGCTCTGGCACCATTGAGGGTGTGCGCTAATTTTCTTTGGCAACTATTGTGGCAAAGGCTGTAGCTTCCAGAGT
GCTAATGCGAAAGCCTAAGACTTCAAGTGTTATTGCTTCCCTTGTGATACCCTAATAATAAATGCATTTGGCGACTCA
page-top