Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig2160
Contig Information
Length 1055 bp
Tissue Dormant seed with water absorption after breaking
Clones 19 Clones [Download: CSV  ,  FASTA ]
whei2m20    whei3l14    whei7k22    whei7m18    whei12f19    whei15k12    whei17c08    whei19i15    whei20g05    whei20k22    whei20p13    rwhei2m20    rwhei7k22    rwhei7m18    rwhei10h06    rwhei17c08    rwhei19i15    rwhei20g05    rwhei20p13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38068 [Oryza sativa Indica Group]
Score 1095
Evalue 1.67285e-117
Total Hit Count 495
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig2160
GGCAGGGAATAAACTAAATATTTAGTTTTAACTCATAACCTCCATCCAGAAAGTAACACGAACAAAATAAGATAACTGAACGCTGGCTAGGAATGTCGAC
AGAAGTACTCAAGAAATCAGCCATCAAAACTGACTACAAAGTTCACGACACCCAGGTGGCACATATATCATCTTCTAGATATGAAGCAGCAAAATAGCGA
CTTCTATTTTCTACTCAGCAGCAGCAACCTCCTCCGCTCCAGGAATCACCTCATCTCCATCAGCAGGCCTGTCAAGCTTCACACCAACATCCTCCTTGTA
GTCACCGTGCACCTCCATGAGCTTCCCCAGGTCAAACTTGGGGGCCTTCAGGATCTTCACCTTGCGGACGTACACGTTCTGGAGGGGGAAGATGCTTGAG
GTGGCCTTCTCAATCTCCTTTCCAATCACCTCAGGGATGAACTTGTTCACAAGCTCCTTCAAGTCACAGCTTGCAGCTTGGTTGACCATGATCTCAACCA
TCTTGCGGCGGATCTGTCTGATCTGACTTGCTTGGGCATAGCAAGTGCGCTTCACCTGGTTTGGGCGTCTCTTGGTGAAGCCAATGGCGAACATGCGGAG
CATGTAGTTGTCAGTGGTCTTCACATCCACATGAGCCTCAATGAGTGTCTGCCACTTCCTCACAAGAGACCTGAGCTTGTCAGTGGTGAAGTCCATGCCC
CAGAAGTTTGTGAGGACATTCATCCCTTGCACATCCTCAGCACGGAGTCTGATCTTCCTGTAGGCCTGGTCCTCATCGTTCTGAAGATCAGCTAGAGATA
CTTCGAACACCCTGTGCTTCAGACCCTCTGAGGCAATCTTGGTACCCTGTGTCCTGGACACGAGGGTCTTGCCGACGTTGCGGCTGGTGAACAGCAGCGG
CGCCTTGATGTCATACCACTGCTTCTTGGTGAACGGATCGACGGCCTTCTTTTTGCTACCCTTCCTCCCCTTGGAGATGCGCTTGTTCTTGCCGACCGCC
ATGGTTGCCGCTGCGGGTGGAGTGGCGGCGCTGCGGCGTCTGGGGGCTGAGCGTC
page-top